В нашей лаборатории уже готова к использованию программа Пикотех 2D. С ее помощью можно уже сегодня установить вторичную 2D структуру белковой молекулы только по нуклеотидной последовательности не затрачивая на это огромное количество времени и финансов!

Определение структуры белка по 3D генетическому коду.

учебные пособия для школ с пикотехнологическими моделями молекул

учебные пособия для школ с пикотехнологическими моделями молекул

Учебные пособия для школ с пикотехнологическими моделями молекул допущены
министерством образования России
.

Модель аминокислоты

Модель аминокислоты Val. Шариками показаны центры атомов, кольцами — валентные электроны.

Модель пептидной группы

Модель пептидной группы. Показаны только валентные электроны.

    На основе пикотехнологических моделей аминокислот предположено, что их взаимное расположение кодируется генетическим кодом. При этом треугольник ABC одного аминокислотного остатка совмещается с треугольником DEF другого аминокислотного остатка с поворотом на 120 градусов.

Аминокислота поворачивается вокруг вертикальной оси (оси симметрии tRNA)

Поворот на 120 градусов относительно оси симметрии tRNA формирует углы альфа-310-,
бета-, пи-спиралей соответственно.

Это — модель ~половины тРНК, т.е. только одна цепь. Должны быть ещё обратные цепи, которые пока не показаны. Конечно, это ещё неправильная модель, но уже «близко к тексту», т.е. в первом приближении тРНК имеет именно такую форму.

Упрощённая (многогранная) модель однонитевой РНК

 

Пикотехнологическая (кольцегранная) модель двухнитевой ДНК

Пикотехнологическая (кольцегранная) модель одной ступени ДНК

Пикотехнологическая (кольцегранная) модель одной ступени ДНК

Упрощённая (многогранная) модель двух ступеней ДНК

Упрощённая (многогранная) модель двух ступеней ДНК

Модель процесса сборки белка рибосомой. Показаны только тРНК и аминокислоты.

Проверка существование 3D genetic code на примере миоглобина:

3D genetic code на примере миоглобина

Рисунок миоглобина, структуру которого определили одной из первых.

Нуклеотидная кодирующая последовательность миоглобина:

>ENA|CAG30402|CAG30402.1 Homo sapiens (human) hypothetical protein
ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCT
GACATCCCAGGCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACT
CTGGAGAAGTTTGACAAGTTCAAGCACCTGAAGTCAGAGGACGAGATGAAGGCATCTGAG
GACTTAAAGAAGCATGGTGCCACTGTGCTCACCGCCCTGGGTGGCATCCTTAAGAAGAAG
GGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAGTCGCATGCCACCAAGCACAAGATC
CCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTTCTGCAGAGCAAGCAT
CCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTGTTCCGG
AAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG

Структура в PDB: https://www.uniprot.org/uniprot/P02144

Мы видим, что аминокислотный остаток Gly, входящий в состав альфа-спирали, закодирован кодом GGC.

Аминокислотный остаток Gly, входящий в состав пи-спирали, закодирован кодом GGT

Аминокислотный остаток Gly, входящий в состав пи-спирали, закодирован кодом GGT.

Код       Структура

GGC      Альфа-спираль

GGA      Бета-спираль

GGT      Пи-спираль

GGG     310-спираль

Сопоставив коды со структурой

в 1992-ом году составили таблицу композиционного генетического кода (3D genetic code):

1 — альфа-спираль

2 — бета-спираль

3 — пи-спираль

4 — 310-спираль

Взаимное расположение аминокислотных остатков в спиралях взята с карты Рамачандрана:

Получилась таблица углов поворота:

alpha-helix  10 30 97

beta-helix     0 120 120

pi-helix         0 30 -60

310-helix     10 30 80

Программа автоматически строит 3D модель фрагмента лизоцима по нуклеотидной последовательности: tgtgctaaacgcgttgttagagacccacaaggtatcagagcttgggttgcttggagaaatcgatgt

Каждый аминокислотный остаток изображается шариком, цвет которого показывал вариант 3D-кода:

GGC — код альфа-спирали. Отмечен красным цветом

GGA — код бета-спирали. Отмечен зеленым цветом

GGT — код пи-спирали. Отмечен голубым цветом

GGG — код 310-спирали. Отмечен оранжевым цветом

Дисульфидный мостик — гарантия достоверности. Случайность исключена.

Входные данные для программы Пикотех: tgtgctaaacgcgttgttagagacccacaaggtatcagagcttgggttgcttggagaaatcgatgt

Подробнее: http://onlinelibrary.wiley.com/doi/10.1 … 4857.x/pdf

PDB-файл: https://yadi.sk/d/DwyG9EZg_JnbGQ

***

Входные данные для программы Пикотех: : tgtcatttatcctgcagtgctttgctgcaagataacatcgctgatgctgtagcttgt

Input data: tgtcacttgtcttgt

***

Входные данные для программы Пикотех: tgcaacatcccgtgctcagccctgctgagctcagacataacagcgagcgtgaactgc

***

Входные данные для программы Пикотех: atggaagctaggagccgggctcccagaagacagctgtgcccgcct

***

Входные данные для программы Пикотех: atgaggtctttgctaatcttggtgctttgcttcctgcccctggctgctctggggaaagtctttggacgatgt

1. Cys 95 — Cys 113 Human lysozime-1

2. Cys 96 — Cys 117 Human lysozime-2

3. Cys 78 — Cys 82 Human lysozime-3

4. Cys 94 — Cys 98 Gallus lysozime-1

5. Met 1 — Cys 13 Mouse lysozime

6. Met 1 — Cys 24 Gallus lysozime-2

Вероятность случайного замыкания 6 фрагментов через дисульфидные мостики порядка 10^-84, т.е. случайность исключена.

Модель оболочки икосаэдрического вируса (фрагмент)

Модель оболочки икосаэдрического вируса

Модель оболочки икосаэдрического вируса. Показана кольцегранная электронная поверхность.

***

На уровне 2D структуры белка пикотехнология уже является коммерческим продуктом.

Программа «Пикотехнология 2D» позволяет определять вторичные структуры белков целыми геномами. Все структуры белков человека были определены на двух персональных компьютерах за одну рабочую неделю: Human Genome Protein Structure

Пример схемы вторичной структуры белка, представляющего собой программную спираль:

Подробнее: https://yadi.sk/i/K9jwT9lakQ0zAA

Алгоритм Пикотех 3D показал, что эта программная спираль белка сопряжена с ДНК.

Тот же белок. Третичная структура.

Тот же белок. Электронная детализация.

Механизм взаимодействия белок-ДНК

***

В 2018-ом году на конкурсе CASP победила компания Deep Mind, используя для поиска гомологов не аминокислотную, а нуклеотидную последовательность: https://deepmind.com/blog/alphafold/

Мы продвинулись дальше. В 1992-ом году нам удалось открыть композиционный генетический код, что позволяет определять структуру белка и без гомологии с надёжностью 100%. Так же, как обычный генетический код позволяет определять первичную структуру белка.

Our results in the competition CASP

Наши результаты на конкурсе CASP

На наши результате организаторы CASP не обратили внимания, т.к. эталоном считается рентгеноструктруный анализ, но он не может отличить пи-спирль от альфа-спирали и программную спираль коллагена от тройной. Поэтому наши результаты были слишком точные для CASP, чтобы признать их верными. Нам не хотели присылать нуклеотидную последовательность, т.к. считалось, что достаточно аминокислотной. Deep Mind оказалась тем мостиком, который позволяет перейти от гомологии по аминокислотной последовательности к гомологии по нуклеотидной последовательности. Ведь в основе гомологии лежит РСА, поэтому его ошибки Deep Mind не заметила, и конфликта с РСА не получилось. Но теперь нужно идти дальше. От гомологии к прямому использованию композиционного генетического кода.

Вы имеете шанс стать первыми пользователями новейшей высокой технологии, основанной на научном открытии композиционного генетического кода.

Поиск программных спиралей по результатам работы геномной версии программы Пикотех 2D (9-я версия)